Indian State Tenders

Indian City Tenders

Why Choose IndianTenders

All India coverage of Tenders
Human Verified Tenders
Realtime updates via website
Daily email alerts in your inbox
Via Email, SMS or Web
Download sample Tenders
Prompt Sales & Support

Home » Tenders By Product » Nucleotide Tenders » Nucleotide Tenders from

Government Nucleotide Online Tenders from 2026

In this section the users can find latest Nucleotide tenders and eProcurement notices from various tendering authorities and private purchasers in . Registered users can download complete tender detail, BOQ, TOR etc for Nucleotide Tenders published by various government tendering authorities in .

The information on Nucleotide online tenders is sourced from various sources like: State Government Eproc Portals, Newspapers, tender bulletin and government online tenders websites.

State: Maharashtra

Supply of Tablet Tenofovir Alenfenamide (Nucleotide ReverseTrainscriptase Inhibitor) Qty 15000 at Mumbai

Ref ID: 130880229

Deadline: 15Jan2026

Value: Refer Document

View Details

State: Uttarakhand

Corrigendum: SHRV IPC2 rev, 5 CAGTCTCGGGCTTGACTAATG 3 21 nucleotides, Qty: 1 Pack, (BOQ Item #74)

Ref ID: 129448977

Deadline: 10Nov2025

Value: Refer Document

View Details

State: Uttarakhand

Corrigendum: SHRV IPC2 fwd, 5 TGGATTCAGTGTAAAGGAGGTTC 3 23 nucleotides, Qty: 1 Pack, (BOQ Item #73)

Ref ID: 129448976

Deadline: 10Nov2025

Value: Refer Document

View Details

State: Uttarakhand

Corrigendum: Shrv 2 R, 5 CTGCGATCCAAAAAC CTTGG 3 20 nucleotides, Qty: 1 Pack, (BOQ Item #72)

Ref ID: 129448975

Deadline: 10Nov2025

Value: Refer Document

View Details

State: Uttarakhand

Corrigendum: Shrv 2 F, 5 AGCGGTCACAGAATG CGATA 3 20 nucleotides, Qty: 1 Pack, (BOQ Item #71)

Ref ID: 129448974

Deadline: 10Nov2025

Value: Refer Document

View Details

State: Uttarakhand

Corrigendum: Shrv 1 R, 5 GTCTCCAATCCAGTAGAGCT 3 20 nucleotides, Qty: 1 Pack, (BOQ Item #70)

Ref ID: 129448973

Deadline: 10Nov2025

Value: Refer Document

View Details

State: Uttarakhand

Corrigendum: Shrv 1 F, 5 GTATGGGTCGAAATACATCTCG 3 22 nucleotides, Qty: 1 Pack, (BOQ Item #69)

Ref ID: 129448972

Deadline: 10Nov2025

Value: Refer Document

View Details

State: Uttarakhand

Corrigendum: Mrgsh 011Rv, 5 CCAGACATACTGACACAGCCCTTC 3 24 nucleotides, Qty: 1 Pack, (BOQ Item #68)

Ref ID: 129448971

Deadline: 10Nov2025

Value: Refer Document

View Details

State: Uttarakhand

Corrigendum: Mrgsh 011Fw, 5 AAAGGTCGGGGGTTTGGACTAATG 3 24 nucleotides, Qty: 1 Pack, (BOQ Item #67)

Ref ID: 129448970

Deadline: 10Nov2025

Value: Refer Document

View Details

State: Uttarakhand

Corrigendum: ISAoic R 5 GCCAAGTGTAAGTGCACTCC 3 21 nucleotides, Qty: 1 Pack, (BOQ Item #33)

Ref ID: 129448875

Deadline: 10Nov2025

Value: Refer Document

View Details

Prev
1
2
3
4
5
....
5
Next

State: {{rowDetails.State_Name}}

Ref ID: {{rowDetails.ID}}

Deadline: {{rowDetails.Bid_Deadline_1}}

Value: {{rowDetails.Tender_Value}}

View Details

No data Found!! Please search again

Prev
{{ $index+1 }}
....
5
Next

Indian State Tenders

Indian City Tenders

Why Choose IndianTenders

Government Nucleotide Online Tenders from 2026

Indian State Tenders

Indian City Tenders

Products/Keywords

Indian Authority Tenders

Browse Tenders